diff --git a/elixir/nucleotide-count/README.md b/elixir/nucleotide-count/README.md
new file mode 100644
index 0000000..4782c89
--- /dev/null
+++ b/elixir/nucleotide-count/README.md
@@ -0,0 +1,55 @@
+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+## Running tests
+
+Execute the tests with:
+
+```bash
+$ elixir nucleotide_count_test.exs
+```
+
+### Pending tests
+
+In the test suites, all but the first test have been skipped.
+
+Once you get a test passing, you can unskip the next one by
+commenting out the relevant `@tag :pending` with a `#` symbol.
+
+For example:
+
+```elixir
+# @tag :pending
+test "shouting" do
+  assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
+end
+```
+
+Or, you can enable all the tests by commenting out the
+`ExUnit.configure` line in the test suite.
+
+```elixir
+# ExUnit.configure exclude: :pending, trace: true
+```
+
+If you're stuck on something, it may help to look at some of
+the [available resources](https://exercism.io/tracks/elixir/resources)
+out there where answers might be found.
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.
diff --git a/elixir/nucleotide-count/nucleotide_count.exs b/elixir/nucleotide-count/nucleotide_count.exs
new file mode 100644
index 0000000..902359f
--- /dev/null
+++ b/elixir/nucleotide-count/nucleotide_count.exs
@@ -0,0 +1,32 @@
+defmodule NucleotideCount do
+  @nucleotides [?A, ?C, ?G, ?T]
+
+  @doc """
+  Counts individual nucleotides in a DNA strand.
+
+  ## Examples
+
+  iex> NucleotideCount.count('AATAA', ?A)
+  4
+
+  iex> NucleotideCount.count('AATAA', ?T)
+  1
+  """
+  @spec count([char], char) :: non_neg_integer
+  def count(strand, nucleotide) do
+    Enum.count(strand, fn n -> n == nucleotide end)
+  end
+
+  @doc """
+  Returns a summary of counts by nucleotide.
+
+  ## Examples
+
+  iex> NucleotideCount.histogram('AATAA')
+  %{?A => 4, ?T => 1, ?C => 0, ?G => 0}
+  """
+  @spec histogram([char]) :: map
+  def histogram(strand) do
+    Map.new(@nucleotides, fn n -> {n, count(strand, n)} end)
+  end
+end
diff --git a/elixir/nucleotide-count/nucleotide_count_test.exs b/elixir/nucleotide-count/nucleotide_count_test.exs
new file mode 100644
index 0000000..b30b76e
--- /dev/null
+++ b/elixir/nucleotide-count/nucleotide_count_test.exs
@@ -0,0 +1,44 @@
+if !System.get_env("EXERCISM_TEST_EXAMPLES") do
+  Code.load_file("nucleotide_count.exs", __DIR__)
+end
+
+ExUnit.start()
+ExUnit.configure(exclude: :pending, trace: true)
+
+defmodule NucleotideCountTest do
+  use ExUnit.Case
+
+  # @tag :pending
+  test "empty dna string has no adenine" do
+    assert NucleotideCount.count('', ?A) == 0
+  end
+
+  # @tag :pending
+  test "repetitive cytosine gets counted" do
+    assert NucleotideCount.count('CCCCC', ?C) == 5
+  end
+
+  # @tag :pending
+  test "counts only thymine" do
+    assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
+  end
+
+  # @tag :pending
+  test "empty dna string has no nucleotides" do
+    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
+    assert NucleotideCount.histogram('') == expected
+  end
+
+  # @tag :pending
+  test "repetitive sequence has only guanine" do
+    expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
+    assert NucleotideCount.histogram('GGGGGGGG') == expected
+  end
+
+  # @tag :pending
+  test "counts all nucleotides" do
+    s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+    expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
+    assert NucleotideCount.histogram(s) == expected
+  end
+end