ruby - nucleotide-count

ruby/nucleotide-count/README.md

@@ -0,0 +1,43 @@
+# Nucleotide Count
+
+Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
+
+The genetic language of every living thing on the planet is DNA.
+DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
+4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
+
+Here is an analogy:
+- twigs are to birds nests as
+- nucleotides are to DNA as
+- legos are to lego houses as
+- words are to sentences as...
+
+* * * *
+
+For installation and learning resources, refer to the
+[Ruby resources page](http://exercism.io/languages/ruby/resources).
+
+For running the tests provided, you will need the Minitest gem. Open a
+terminal window and run the following command to install minitest:
+
+    gem install minitest
+
+If you would like color output, you can `require 'minitest/pride'` in
+the test file, or note the alternative instruction, below, for running
+the test file.
+
+Run the tests from the exercise directory using the following command:
+
+    ruby nucleotide_count_test.rb
+
+To include color from the command line:
+
+    ruby -r minitest/pride nucleotide_count_test.rb
+
+
+## Source
+
+The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
+
+## Submitting Incomplete Solutions
+It's possible to submit an incomplete solution so you can see how others have completed the exercise.

ruby/nucleotide-count/nucleotide_count.rb

@@ -0,0 +1,26 @@
+# Nucleotide class
+class Nucleotide
+  attr_accessor :histogram
+
+  def initialize(strand)
+    @strand = strand
+    @histogram = { 'A' => 0, 'T' => 0, 'C' => 0, 'G' => 0 }
+    count_all
+  end
+
+  def self.from_dna(strand)
+    raise ArgumentError if strand =~ /[^ATCG]/
+
+    new(strand)
+  end
+
+  def count(nucleotide)
+    @histogram[nucleotide]
+  end
+
+  private
+
+  def count_all
+    @histogram.each { |n, _| @histogram[n] = @strand.chars.count(n) }
+  end
+end

ruby/nucleotide-count/nucleotide_count_test.rb

@@ -0,0 +1,53 @@
+require 'minitest/autorun'
+require_relative 'nucleotide_count'
+
+class NucleotideTest < Minitest::Test
+  def test_empty_dna_strand_has_no_adenosine
+    assert_equal 0, Nucleotide.from_dna('').count('A')
+  end
+
+  def test_repetitive_cytidine_gets_counted
+    # skip
+    assert_equal 5, Nucleotide.from_dna('CCCCC').count('C')
+  end
+
+  def test_counts_only_thymidine
+    # skip
+    assert_equal 1, Nucleotide.from_dna('GGGGGTAACCCGG').count('T')
+  end
+
+  def test_counts_a_nucleotide_only_once
+    # skip
+    dna = Nucleotide.from_dna('CGATTGGG')
+    dna.count('T')
+    dna.count('T')
+    assert_equal 2, dna.count('T')
+  end
+
+  def test_empty_dna_strand_has_no_nucleotides
+    # skip
+    expected = { 'A' => 0, 'T' => 0, 'C' => 0, 'G' => 0 }
+    assert_equal expected, Nucleotide.from_dna('').histogram
+  end
+
+  def test_repetitive_sequence_has_only_guanosine
+    # skip
+    expected = { 'A' => 0, 'T' => 0, 'C' => 0, 'G' => 8 }
+    assert_equal expected, Nucleotide.from_dna('GGGGGGGG').histogram
+  end
+
+  def test_counts_all_nucleotides
+    # skip
+    s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
+    dna = Nucleotide.from_dna(s)
+    expected = { 'A' => 20, 'T' => 21, 'G' => 17, 'C' => 12 }
+    assert_equal expected, dna.histogram
+  end
+
+  def test_validates_dna
+    # skip
+    assert_raises ArgumentError do
+      Nucleotide.from_dna('JOHNNYAPPLESEED')
+    end
+  end
+end