elixir - nucleotide-count

This commit is contained in:
2018-10-04 14:24:48 -04:00
parent 2362c2cf15
commit e28b0dbb4d
3 changed files with 131 additions and 0 deletions

View File

@@ -0,0 +1,55 @@
# Nucleotide Count
Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
The genetic language of every living thing on the planet is DNA.
DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
Here is an analogy:
- twigs are to birds nests as
- nucleotides are to DNA as
- legos are to lego houses as
- words are to sentences as...
## Running tests
Execute the tests with:
```bash
$ elixir nucleotide_count_test.exs
```
### Pending tests
In the test suites, all but the first test have been skipped.
Once you get a test passing, you can unskip the next one by
commenting out the relevant `@tag :pending` with a `#` symbol.
For example:
```elixir
# @tag :pending
test "shouting" do
assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
end
```
Or, you can enable all the tests by commenting out the
`ExUnit.configure` line in the test suite.
```elixir
# ExUnit.configure exclude: :pending, trace: true
```
If you're stuck on something, it may help to look at some of
the [available resources](https://exercism.io/tracks/elixir/resources)
out there where answers might be found.
## Source
The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
## Submitting Incomplete Solutions
It's possible to submit an incomplete solution so you can see how others have completed the exercise.

View File

@@ -0,0 +1,32 @@
defmodule NucleotideCount do
@nucleotides [?A, ?C, ?G, ?T]
@doc """
Counts individual nucleotides in a DNA strand.
## Examples
iex> NucleotideCount.count('AATAA', ?A)
4
iex> NucleotideCount.count('AATAA', ?T)
1
"""
@spec count([char], char) :: non_neg_integer
def count(strand, nucleotide) do
Enum.count(strand, fn n -> n == nucleotide end)
end
@doc """
Returns a summary of counts by nucleotide.
## Examples
iex> NucleotideCount.histogram('AATAA')
%{?A => 4, ?T => 1, ?C => 0, ?G => 0}
"""
@spec histogram([char]) :: map
def histogram(strand) do
Map.new(@nucleotides, fn n -> {n, count(strand, n)} end)
end
end

View File

@@ -0,0 +1,44 @@
if !System.get_env("EXERCISM_TEST_EXAMPLES") do
Code.load_file("nucleotide_count.exs", __DIR__)
end
ExUnit.start()
ExUnit.configure(exclude: :pending, trace: true)
defmodule NucleotideCountTest do
use ExUnit.Case
# @tag :pending
test "empty dna string has no adenine" do
assert NucleotideCount.count('', ?A) == 0
end
# @tag :pending
test "repetitive cytosine gets counted" do
assert NucleotideCount.count('CCCCC', ?C) == 5
end
# @tag :pending
test "counts only thymine" do
assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
end
# @tag :pending
test "empty dna string has no nucleotides" do
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
assert NucleotideCount.histogram('') == expected
end
# @tag :pending
test "repetitive sequence has only guanine" do
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
assert NucleotideCount.histogram('GGGGGGGG') == expected
end
# @tag :pending
test "counts all nucleotides" do
s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
assert NucleotideCount.histogram(s) == expected
end
end