elixir - nucleotide-count
This commit is contained in:
@@ -0,0 +1,55 @@
|
|||||||
|
# Nucleotide Count
|
||||||
|
|
||||||
|
Given a single stranded DNA string, compute how many times each nucleotide occurs in the string.
|
||||||
|
|
||||||
|
The genetic language of every living thing on the planet is DNA.
|
||||||
|
DNA is a large molecule that is built from an extremely long sequence of individual elements called nucleotides.
|
||||||
|
4 types exist in DNA and these differ only slightly and can be represented as the following symbols: 'A' for adenine, 'C' for cytosine, 'G' for guanine, and 'T' thymine.
|
||||||
|
|
||||||
|
Here is an analogy:
|
||||||
|
- twigs are to birds nests as
|
||||||
|
- nucleotides are to DNA as
|
||||||
|
- legos are to lego houses as
|
||||||
|
- words are to sentences as...
|
||||||
|
|
||||||
|
## Running tests
|
||||||
|
|
||||||
|
Execute the tests with:
|
||||||
|
|
||||||
|
```bash
|
||||||
|
$ elixir nucleotide_count_test.exs
|
||||||
|
```
|
||||||
|
|
||||||
|
### Pending tests
|
||||||
|
|
||||||
|
In the test suites, all but the first test have been skipped.
|
||||||
|
|
||||||
|
Once you get a test passing, you can unskip the next one by
|
||||||
|
commenting out the relevant `@tag :pending` with a `#` symbol.
|
||||||
|
|
||||||
|
For example:
|
||||||
|
|
||||||
|
```elixir
|
||||||
|
# @tag :pending
|
||||||
|
test "shouting" do
|
||||||
|
assert Bob.hey("WATCH OUT!") == "Whoa, chill out!"
|
||||||
|
end
|
||||||
|
```
|
||||||
|
|
||||||
|
Or, you can enable all the tests by commenting out the
|
||||||
|
`ExUnit.configure` line in the test suite.
|
||||||
|
|
||||||
|
```elixir
|
||||||
|
# ExUnit.configure exclude: :pending, trace: true
|
||||||
|
```
|
||||||
|
|
||||||
|
If you're stuck on something, it may help to look at some of
|
||||||
|
the [available resources](https://exercism.io/tracks/elixir/resources)
|
||||||
|
out there where answers might be found.
|
||||||
|
|
||||||
|
## Source
|
||||||
|
|
||||||
|
The Calculating DNA Nucleotides_problem at Rosalind [http://rosalind.info/problems/dna/](http://rosalind.info/problems/dna/)
|
||||||
|
|
||||||
|
## Submitting Incomplete Solutions
|
||||||
|
It's possible to submit an incomplete solution so you can see how others have completed the exercise.
|
||||||
@@ -0,0 +1,32 @@
|
|||||||
|
defmodule NucleotideCount do
|
||||||
|
@nucleotides [?A, ?C, ?G, ?T]
|
||||||
|
|
||||||
|
@doc """
|
||||||
|
Counts individual nucleotides in a DNA strand.
|
||||||
|
|
||||||
|
## Examples
|
||||||
|
|
||||||
|
iex> NucleotideCount.count('AATAA', ?A)
|
||||||
|
4
|
||||||
|
|
||||||
|
iex> NucleotideCount.count('AATAA', ?T)
|
||||||
|
1
|
||||||
|
"""
|
||||||
|
@spec count([char], char) :: non_neg_integer
|
||||||
|
def count(strand, nucleotide) do
|
||||||
|
Enum.count(strand, fn n -> n == nucleotide end)
|
||||||
|
end
|
||||||
|
|
||||||
|
@doc """
|
||||||
|
Returns a summary of counts by nucleotide.
|
||||||
|
|
||||||
|
## Examples
|
||||||
|
|
||||||
|
iex> NucleotideCount.histogram('AATAA')
|
||||||
|
%{?A => 4, ?T => 1, ?C => 0, ?G => 0}
|
||||||
|
"""
|
||||||
|
@spec histogram([char]) :: map
|
||||||
|
def histogram(strand) do
|
||||||
|
Map.new(@nucleotides, fn n -> {n, count(strand, n)} end)
|
||||||
|
end
|
||||||
|
end
|
||||||
@@ -0,0 +1,44 @@
|
|||||||
|
if !System.get_env("EXERCISM_TEST_EXAMPLES") do
|
||||||
|
Code.load_file("nucleotide_count.exs", __DIR__)
|
||||||
|
end
|
||||||
|
|
||||||
|
ExUnit.start()
|
||||||
|
ExUnit.configure(exclude: :pending, trace: true)
|
||||||
|
|
||||||
|
defmodule NucleotideCountTest do
|
||||||
|
use ExUnit.Case
|
||||||
|
|
||||||
|
# @tag :pending
|
||||||
|
test "empty dna string has no adenine" do
|
||||||
|
assert NucleotideCount.count('', ?A) == 0
|
||||||
|
end
|
||||||
|
|
||||||
|
# @tag :pending
|
||||||
|
test "repetitive cytosine gets counted" do
|
||||||
|
assert NucleotideCount.count('CCCCC', ?C) == 5
|
||||||
|
end
|
||||||
|
|
||||||
|
# @tag :pending
|
||||||
|
test "counts only thymine" do
|
||||||
|
assert NucleotideCount.count('GGGGGTAACCCGG', ?T) == 1
|
||||||
|
end
|
||||||
|
|
||||||
|
# @tag :pending
|
||||||
|
test "empty dna string has no nucleotides" do
|
||||||
|
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 0}
|
||||||
|
assert NucleotideCount.histogram('') == expected
|
||||||
|
end
|
||||||
|
|
||||||
|
# @tag :pending
|
||||||
|
test "repetitive sequence has only guanine" do
|
||||||
|
expected = %{?A => 0, ?T => 0, ?C => 0, ?G => 8}
|
||||||
|
assert NucleotideCount.histogram('GGGGGGGG') == expected
|
||||||
|
end
|
||||||
|
|
||||||
|
# @tag :pending
|
||||||
|
test "counts all nucleotides" do
|
||||||
|
s = 'AGCTTTTCATTCTGACTGCAACGGGCAATATGTCTCTGTGTGGATTAAAAAAAGAGTGTCTGATAGCAGC'
|
||||||
|
expected = %{?A => 20, ?T => 21, ?C => 12, ?G => 17}
|
||||||
|
assert NucleotideCount.histogram(s) == expected
|
||||||
|
end
|
||||||
|
end
|
||||||
Reference in New Issue
Block a user